Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13572E5
Clone ID IST13572E5
Vector VICTR74
Project tigm

Sequence tag IST13572E5HMR1
Sequence
GGTGGAGTTTCTATTATCGTTACCCAATTTTGTAGGACTGGTTAAACTGTTAAGAAGGAAAACAATTTTCTCTCTTTTTT
TTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI14668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 80197451..80197541 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017421 (Zfp207) NP_035881 zinc finger protein 207 Gene [Source:MGI (curated);Acc:Zfp207-002]


Sequence tag IST13572E5HMF1
Sequence
ACCCANTTAANCAACCNNTTCCCCAANATTAANGNGCCCNAAAGAAANGCGGAAGCCGATTCTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000017421


For any suggestions or comments, please send an email to unitrap@crg.es