Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14461D4
Clone ID IST14461D4
Vector VICTR74
Project tigm

Sequence tag IST14461D4HMR1
Sequence
GAGACAGGAAAAGAGCCGAGAGGTCGAGATCAGAAGCGAGACCTTGAAGGGGGAGCAGTGCGGGGGCGGGGCGAGAGGCG
GGACCAGGCCGGGGTGCGCCTCGGTTGATGGCGGACCGGTGGGGCGAGGATGGGTGTGGGGACGCCCCGGTGGANATGCT
GCTGACNNAAGCTTTTCTCTCCCGCCTCTCNNTCNCGCNNNNNANGCCCTTANCCNNGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14461D4BBF1
Sequence
GTCTCAACGCCCCTTATGAACCCACCCGAAAAAGGGTGCAACTGTCGGGACGCTGGAACAAACAAGTTTTTCTCTCCAGC
TTGGAGAGCTCCAACGTGGCTGAGAACTCCGAGCCGGAAATGGAAGTGACGTCACGGCCAGCCCCCCCTTTTCTCCGAGC
TCTGAGTCCTTCTCGGCGTTTGTCCGAGGGCTCTCCACGCAGCGCTCGGTGAGGATTCGGTGAGGAGCTGCGGGGGCGGC
GCGGGGAGGGCGAGGACTCGGTAGGCCTGTGCGGGGAGGCGGGCCNANCTCTGCTCGCGGGGTCCCGCGGCTTCCNGGGC
TCTGNNNCCNNCNNNGN
Sequence Type genomic DNA
Unitrap ID UNI34634

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20325683..20326006 318
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060510 (5730601F06Rik) NP_001128491 RIKEN cDNA 5730601F06 gene Gene [Source:MGI Symbol;Acc:MGI:1924769]

 
Come back to gene ENSMUSG00000060510


For any suggestions or comments, please send an email to unitrap@crg.es