Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14631F8
Clone ID IST14631F8
Vector VICTR74
Project tigm

Sequence tag IST14631F8HMR1
Sequence
GCTGATTTTACAAAATCNTGGGCTTCGTTATGTANTTTGAAATCTACACACACAGAGTGTACCTGGTCTCTCCCATCCTT
CCANATAGTACCCTGCTATACTTTCTTGTCGTCTCCCCCTATCTTTTTGAAAACCTTTATTTACATATATGTGTCTATCT
CTGGGCTCGAGTACCGGAGTTCATGTGTAGAGGTCAGAGTACC
Sequence Type genomic DNA
Unitrap ID UNI6196

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 97382035..97382236 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031783 (Polr2c) NM_009090 polymerase (RNA) II (DNA directed) polypeptide C Gene [Source:MGI Symbol;Acc:MGI:109299]


Sequence tag IST14631F8HMF1
Sequence
CAGCATATATGTTCAAAAGACACCAGCCAGTAGCGAACACTGACGTCAAAGCAAAAGCGCATCATCTACACTACTTCGGC
AATCGCTGCATCACCTGCTAACGACGCCTAGCATCTACACCGCCCGGATGAGGAGGCTGCAGCCCTCCGCTGTTTAACAG
TGCTTGGTTTTGATTTCTGTTGCTTTGGGGTANACNAACAGTACTGGGAAACCCGCAGCTGANCAAGGCACGCACCAAGG
CGGGCCTANGCTGCCCCAGCCCAGCGTACAGCNCCGCANTGTTCTCAGCCCCCACCCCGGGCGGANGGTGGGCGGCACGG
GCTCCCAGGGACGGTCNCTTACCTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 97381694..97382038 329
 
EST/CDNA Est Name
  EH111807.1

 
Come back to gene EH111807.1


For any suggestions or comments, please send an email to unitrap@crg.es