Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14481E6
Clone ID IST14481E6
Vector VICTR74
Project tigm

Sequence tag IST14481E6BBF1
Sequence
AACTATCCCAGAGTTGGTTTAAAAATGAGATTTATTAACCGGGTGTGGTGGCGCACACCTTTAATCCCAGCACTCGGGAG
GCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTATACAA
AGAAATCCTGTCTTGAAAAACCAAAAAAAAAAAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI24703

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 69721565..69721766 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051730 (Mettl5) NM_029280 methyltransferase like 5 Gene [Source:MGI (curated);Acc:Mettl5-001]


Sequence tag IST14481E6HMR1
Sequence
GTTAATTACTGTTGCAGGTACTTTGAAACTCATGTCGTGCACATTANAAACTAGGTATGAAAGAACTGATTATGTATGTA
TGTATTTGTTTGCTTGTTTATTTTGAGACAGTGTCTGGTTATATAACCCTAGTTGGCCTGGCTATATGGTCCAGGCTGGT
CTTGAATTCNCANTGATCTACCTGCCTCTGCCTCCCAANTGCANGAATTAANGGAATGTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 69721764..69721984 209
 
EST/CDNA Est Name
  CA895906.1


Sequence tag IST14481E6HMF1
Sequence
AACTATCCCAGAGTTGGTTTAAAAATGAGATTTATTAACCGGGTGTGGTGGCGCACACCTTTAATCCCAGCACTCGGGAG
GCAGAGGCAGGCGGATTTCTGAGTTCGAGGCCAGCCTCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGCTATACAA
AGAAATCCTGTCTTGAAAAACCAAAAAAAAAAAAAAAAANAAA
Sequence Type genomic DNA
Unitrap ID UNI24703

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 69721565..69721766 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051730 (Mettl5) NM_029280 methyltransferase like 5 Gene [Source:MGI (curated);Acc:Mettl5-001]

 
Come back to gene ENSMUSG00000051730


For any suggestions or comments, please send an email to unitrap@crg.es