Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10056A8
Clone ID IST10056A8
Vector VICTR75
Project tigm

Sequence tag IST10056A8HMF3
Sequence
TACTCAGTTGTGCATATAAAAACATGTTAGGTCCCCAAGGATGGATTAGTTACCTTATGTCTTTATCAGCATTCCAAATT
AGGCACACTAAATAAATATGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 61864014..61864115 102
NO GENE  


Sequence tag IST10056A8BBR1
Sequence
GGGGCACCCCCTCTTCCAGATTTGATTTTTCAAATGGCATCTGATACTTGACAGCCATGGCCCAAGAGTCTCCTGGCACC
TGCATCATCTTAGCACAGAATGAGTTTCTTCTTAGGAAAAATACATTTGCCAAAGCCACGTGACCTTTTCTATCTCAAGA
AGGTGGCATTTATCCTTTCTGCATACGTTGTCCCTCTGTCCCTTCTTTTCTTCCCTTTTACCTTGAGGGATCCG
Sequence Type genomic DNA
Unitrap ID UNI30557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117085064..117085296 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST10056A8BBF2
Sequence
CCCCCGCCCCCTGTAACAAGCTTGGAGGACTTGCAGGGGGACCAGCCATTGTAAATGGCCACCTTGTACTTCTGTCAGCC
TCTCTGCCTGCTAGGCTTTAACATTCTGCTGTGAGCACAGGGACCAGAGGCCATCATCAGAAGGTGTAAGCCCCAAGTAT
TCTAGTGAAGTTTTGCTGTCCCGGTCATTTGTGTCCACCATTTGTAGCGTCGCCCCAGCGCTAGCCTGCCTTGTACCCAG
AGCGCATGATTTCTGAGGAGCTTCAGAAATGCCTTACATCACTGGAGAAGCTTAGGAAGGACCTGGAAGGCTGCCTAAAA
CACAGACTGCCAGGCCTGCATCCTGGGTCTCTGGGCCTGACGACTGGATGAGCATCTTTGGGTGATGTGGATGCTCTTGG
TTAACGGACTGGTTTCTGTTGGTTGTTTGTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117085293..117085721 416
 
EST/CDNA Est Name
  CN660411.1 - CN662315.1 - CN662953.1

 
Come back to gene CN660411.1 - CN662315.1 - CN662953.1


For any suggestions or comments, please send an email to unitrap@crg.es