Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15095C2
Clone ID IST15095C2
Vector VICTR80
Project tigm

Sequence tag IST15095C2HMR1
Sequence
NNNNNTGTGAATTCTGTGATAAAGGCTTTCTTTTCTACTCTTTCCCCAATGANCACAANATANATGCTCAATAAATACTT
GTTGAATTAATTCATTANCTGAAAAGCATTTCCGTCCTTCCTCCCCAGTGGCTGCAGTGGCTGCCGTGGCTGCAGCCTGT
GTAAGGTGTGCCCAGGCTGTCTTTCTCCATTTTCTAATAGCCTCC
Sequence Type genomic DNA
Unitrap ID UNI30557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117088613..117088812 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST15095C2HMF1
Sequence
GAATGACCTCCCGAACCCCCCAAAATCTCACCTCAGGCTTCTGGATGACTAATATATGCCATTGTGCCTTGCTTCGGTTT
CAGTTATTAGGACACCCTGTACCCTAGCTGACCAAGACTGAGGGTGATTTCACTGCCTCAACGTGAAAGACGTGCCCATC
ACCTCATCTTAGCATGAGATTTGAGTCTTGGGTTTGTTGAGTTTTACTTTGTGTTTTGAGCAAGGATCTCTCACCTTCCA
GCTGGGGCTGGCTGGGAACTTACAGATGTGGACCTGCTAAGTGCTAGAGTTAAAGGGCACTATGCAAAAGCTGTAACCCA
GGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73221385..73221708 324
 
EST/CDNA Est Name
  BF458861.1 - BF458863.1

 
Come back to gene BF458861.1 - BF458863.1


For any suggestions or comments, please send an email to unitrap@crg.es