Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13928F12
Clone ID IST13928F12
Vector VICTR74
Project tigm

Sequence tag IST13928F12HMF2
Sequence
GTGTGTCCTTGAGGAGAATCTTCTCTCTTGTAGCAATAGAGCTCAAGTTGCAGAAAATCAAACAGAAACTCTCATTGTAA
GGTTGGCTGAACTACAGCGAAAATTCAAGTCTCAGCCTCAGAGTGTGTCC
Sequence Type genomic DNA
Unitrap ID UNI31001 UNI31002 UNI31003

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11248714..11248842 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048960 (Depdc2) NP_001028808 phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2 Gene [Source:MGI Symbol;Acc:MGI:1923385]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 51926444..51926572 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7486417..7486545 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 18970314..18970442 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 12746324..12746452 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8901082..8901210 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 5632624..5632752 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11334321..11334449 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 9923998..9924126 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 24712570..24712698 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 44293871..44293999 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025202 (Scd3) NM_024450 stearoyl-coenzyme A desaturase 3 Gene [Source:MGI Symbol;Acc:MGI:1353437]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 25655984..25656112 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 6910806..6910934 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 20866836..20866964 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 7526369..7526497 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 61729670..61729798 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079548 (AC125119.2)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 11411026..11411154 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3773517..3773645 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 8049097..8049225 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166281: 190253..190381 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166447: 45871..45999 129
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 48920715..48920843 129
NO GENE  


Sequence tag IST13928F12BBF1
Sequence
GTGTGTCCTTGAGGAGAATCTTCTCTCTTGTAGCAATAGAGCTCAAGTTGCAGAAAATCAAACAGAAACTCTCATTGTAA
GGTTGGCTGAACTACAGCGAAAATTCAAGTCTCAGCCTCAGAGTGTGTCGACAGTTAAAGTAAGGGCTCTAATTGGCAAA
GAATGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI31001 UNI31002 UNI31003

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166447: 45871..46040 170
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166281: 190212..190381 170
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 44293871..44294040 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025202 (Scd3) NM_024450 stearoyl-coenzyme A desaturase 3 Gene [Source:MGI Symbol;Acc:MGI:1353437]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 24712570..24712739 170
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 9923998..9924167 170
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 11334321..11334490 170
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 5632624..5632793 170
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 12746324..12746493 170
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 18970314..18970483 170
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7486417..7486586 170
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 8049097..8049266 170
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8901082..8901251 170
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 51926444..51926613 170
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3773517..3773686 170
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 61729670..61729839 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079548 (AC125119.2)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 11411026..11411195 170
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 7526369..7526538 170
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 20866836..20867005 170
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 6910806..6910975 170
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 48920715..48920884 170
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 25655984..25656153 170
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11248714..11248883 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048960 (Depdc2) NP_001028808 phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2 Gene [Source:MGI Symbol;Acc:MGI:1923385]

 
Come back to gene ENSMUSG00000048960


For any suggestions or comments, please send an email to unitrap@crg.es