Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14803A6
Clone ID IST14803A6
Vector VICTR76
Project tigm

Sequence tag IST14803A6HMR1
Sequence
NNGAAAAGGCANTGANCTCANCCNCNNGGGTGTCAGGAGGCATGGAATGCTCTCAAGGAAGGCAGTGTCATGATTCANCT
CGTGTTTTCAAAAACTCACCCTGGTGGCTGTGTGTAAGATGGATTATGGATTGAAGAGGGAAGGCAGGCGACAAGANGAG
GGGGAACTGANGAGCCACTGGGGGANACNAANACNCNNCNCCTGANGCTGGGCCTGANTGCCCCCTGCCTGTGANGCTNT
GAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14803A6HMF1
Sequence
TTAGTGACTTCAAGTAGATGTCTCCTCACCTCTCTGCTCGAGTTCCCAGGGCTTCACTCCCCTGGCACTTTGGGAGTGGG
AGGAGAGCATCATGACTAGGGTTTTCTTCTCAGAGGAATCATTGTTGGTCTATAGAAAACCATCACTGGA
Sequence Type genomic DNA
Unitrap ID UNI11248

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115540827..115540974 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029550 (Sppl3) NM_029012 signal peptide peptidase 3 Gene [Source:MGI (curated);Acc:Sppl3-001]


Sequence tag IST14803A6BBF1
Sequence
TTAGTGACTTCAAGTAGATGTCTCCTCACCTCTCTGCTCGAGTTCCCAGGGCTTCACTCCCCTGGCACTTTGGGAGTGGG
AGGAGAGCATCATGACTAGGGTTTTCTTCTCAGAGGAATCATTGTTGGTCTATAGAAAACCATCACTGGCCAGGCCAGCC
TGCTCTACATGGTGAGATGGGGGTN
Sequence Type genomic DNA
Unitrap ID UNI11248

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115540827..115541009 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029550 (Sppl3) NM_029012 signal peptide peptidase 3 Gene [Source:MGI (curated);Acc:Sppl3-001]

 
Come back to gene ENSMUSG00000029550


For any suggestions or comments, please send an email to unitrap@crg.es