Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11111A10
Clone ID IST11111A10
Vector VICTR76
Project tigm

Sequence tag IST11111A10BBF1
Sequence
ACTTCATAGACCAGGCAGGCCTTGAACTCAGAAATCCGCCTGCCTCTGCCTCCCAAGTGCTGGGATTAAAG
Sequence Type genomic DNA
Unitrap ID UNI31060 UNI34637

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6581952..6582022 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 18001219..18001289 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69295406..69295476 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005237 (Dnahc2) NM_001081330 dynein, axonemal, heavy chain 2 Gene [Source:MGI (curated);Acc:Dnahc2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 72154724..72154794 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 57742066..57742136 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 132267267..132267337 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027345 (4921508D12Rik) RIKEN cDNA 4921508D12 gene Gene [Source:MGI Symbol;Acc:MGI:1918095]


Sequence tag IST11111A10HMF2
Sequence
ACTTNATANACNAGGCAGGCCTTGAACTCANAAATCCGCCTGCCTCTGCCTNCCAAGTGCTGGGATTAAANGTGTGCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000027345


For any suggestions or comments, please send an email to unitrap@crg.es