Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14241G12
Clone ID IST14241G12
Vector VICTR74
Project tigm

Sequence tag IST14241G12HMF1
Sequence
GTCTTCAGACAAAATCTTTTCCAGGAGGTAAGTCTCTGAATTCAGTCGATGTAACCCAGAGTCTTAGTGCAGAACTCTAG
GGCCACAAGCTCTGAGTAACCCACCAGTTCACCTTAATTTTGGTGTCTCCGAACCTTCATGCTTACTCAAGGTGAACTGC
AATGATTTGTTTCTACTTGTAATCTGATCAATCTTAGAACTCTTAACTGCTTTTGCCACTCCCCTTGAATGGAAAGGTAA
AGATGTCGCCCAAAGGGAAAACCCCATAGCCCTACTTCTGCCCTTCATGAGATTGGGCAAGTCCCTTTATTTCCAGGGCT
AGGGTTTCCTCATACGAGAGTCTTGAGCTCAGTGATTTCCATGGGCCAACTTCTGATACGTATCAACAAACCTCTTGCAT
GATTATTTTTGTAATGTAACTTGCAGGCTGATGACTTCCTCTGCACTTTCTTGCCNCGGAAAATCNTATCCCTGANTCAG
CTCTTGCNNGTGAGTANTATANACCCCTCTGCTCCATCTCCTGANNCCTCTNATCANCCNNCTGANGGGCNTCAN
Sequence Type genomic DNA
Unitrap ID UNI24457

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 56208805..56209358 524
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079197 (Psme2) proteasome (prosome, macropain) 28 subunit, beta Gene [Source:MGI Symbol;Acc:MGI:1096365]


Sequence tag IST14241G12HMR1
Sequence
AAGACATCCACCTGCNCAGACAGAAGTNNNNNNGATGCTGGTTAGGGTTTAGTTTGTATAGAATAAGGGCCCACTCCCAA
CCTAGGTGCCTTCCAACTCTAGCCCAAACCTGTCCCACAAAGCTAGTTTCCCCCTGGAGGAGCCTGCTCAGTGCACAGAT
TGGCTCGAGGACACGGCACTGGCAATCCCTGANCANAANTGAAAGAAAGCCCTAAAGAAAGAGAGGCCGGTGGAGTTCGC
TCGCAAGGCCCCATTGGTGCCCAGGAGCACCGAGCTTTATCTCCGTTAGGACTTCTCACTCCTTCCTGGCTTCNGTTCCC
ATTTACCTGTTTTCGGGCTTCTCCACTCAAGCGGACCCNACAAGGCTTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 56209354..56209721 343
 
EST/CDNA Est Name
  AK088654.1 - BC057859.1 - AK012344.1 - AK143556.1 - D87910.1 - NM_001029855.1 - NM_011190.3 - BC005680.1 - U60329.1


Sequence tag IST14241G12BBF1
Sequence
GTCTTCAGACAAAATCTTTTCCAGGAGGTAAGTCTCTGAATTCAGTCGATGTAACCCAGNNTCTTAGTGCAGAACTCTAG
GGCCACAAGCTCTGAGTAACCCACCAGTTCACCTTAATTTTGGTGTCTCCGAACCTTCATGCTTACTCAAGGTGAACTGC
AATGATTTGTTTCTACTTGTAATCTGATCAATCTTAGAACTCTTAACTGCTTTTGCCACTCCCCTTGAATGGAAAGGTAA
AGATGTCGCCCAAAGGGAAAACCCCATAGCCCTACTTCTGCCCTTCATGAGATTGGGCAAGTCCCTTTATTTCCAGGGCT
AGGGTTTCCTCATACGAGAGTCTTGAGCTCAGTGATTTCCATGGGCCNACTTCTGATACGTANCNNNNAACCTCTTGCAT
GATTATTTTTGTAATGTAACTTGCANGCTGATGACTTCCTCTGCACTTTCTTGCCACGGAAAATCNTATCCCTGAGTCAG
CTCTTGCANGTGAGTAGTATAGACCCCTCTGCTCCATCTCCTGANNNCTCTN
Sequence Type genomic DNA
Unitrap ID UNI24457

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 56208828..56209358 503
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079197 (Psme2) proteasome (prosome, macropain) 28 subunit, beta Gene [Source:MGI Symbol;Acc:MGI:1096365]

 
Come back to gene ENSMUSG00000079197


For any suggestions or comments, please send an email to unitrap@crg.es