Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14744G4
Clone ID IST14744G4
Vector VICTR76
Project tigm

Sequence tag IST14744G4HMF1
Sequence
GAGTGCCTGCCTAGCATGCATACAAAGCCTCGAGTTTGATCCCAAACACCCCATAAAACTGGGTGTGATGGTCACTCTTG
ATGTCCCAGCACTGGGAAGGTGGA
Sequence Type genomic DNA
Unitrap ID UNI8149

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 27806891..27806993 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019889 (Ptprk) NM_008983 protein tyrosine phosphatase, receptor type, K Gene [Source:MGI Symbol;Acc:MGI:103310]


Sequence tag IST14744G4HMR1
Sequence
ACTCTACTAAAGGAGCTACAGCCTCATTCCCAGAAAGAGTATTTTCTAAGTCTTCGTAACTATCCAAAAGAAAAATACTT
CCACATGCAATATGTCACACATGATCGTAATTAGAACATATGCTTACCCATGTTCAATAGGACTATCTTATACAGTATTT
ACTGGCATAGCTAGAAAACTTATTTCTAGGTATTTGGTANCATTTATATGTATGTGAAAATGAAATGGGGGGAGCTACAC
TGGGTGATACATAACAGCAGAATTTCCAATTGTTCACNNNANCNNNNTNNNCTCNTANTTANCATANCAGTTTCCCTGGC
ATTTACATANGCACTGCATAACTCANACATGAATATATATAANGCATCTACGGGTCCTCATTTTCATTCTCCNGCAGATC
CACTTCCTATGCCTTCAACANCAATTTATTTATCACCAAAGTTTACATCCNTAACTGCNNTTGCATTTTATGTGAGTTTA
CAATTATAGGAGAATTTTCNCATACNTTGCTCATCTCTTCNTTAAAGANGTCTGGCNAAATANCGANANNANACNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000019889


For any suggestions or comments, please send an email to unitrap@crg.es