Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11541C7
Clone ID IST11541C7
Vector VICTR76
Project tigm

Sequence tag IST11541C7BBF1
Sequence
AACTAGTAAGTTTTCAAGTGTTGCTTCTCAAATATATTGTGGATCATCCCTCTNAATATTAATTTTGGTACAGTAGAGGA
GGAAACACATACACACATTAAAAGATGGCTAGCCCTGACTTTGTTTGGACTTCTATATTGTGTCATGATTTCNTAGACCT
GCTCTTTTGTCTTGANGNNTACCCTTTNCCCGN
Sequence Type genomic DNA
Unitrap ID UNI30172

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34723482..34723673 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028295 (1810030N24Rik) NM_025471 RIKEN cDNA 1810030N24 gene Gene [Source:MGI Symbol;Acc:MGI:1913541]


Sequence tag IST11541C7HMR1
Sequence
CTANGGACAGTTCCCAGAGCCCACATGGTGGCTACAACTGCCTGCAATTCTAGTTCCAGGGGTCCAATGCTCTCTCCTGG
CCTCCATGGGTACCAGACACGCACATGGTGCATATATATACACACACAGACAAATACTTATTCACACAAAATAAGCACCA
NACCCCACTCCTCCCTGAGGAACTATTANCANTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34723726..34723919 186
 
EST/CDNA Est Name
  BU938248.1 - AA060440.1 - BE137959.1

 
Come back to gene BU938248.1 - AA060440.1 - BE137959.1


For any suggestions or comments, please send an email to unitrap@crg.es