Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11858E10
Clone ID IST11858E10
Vector VICTR76
Project tigm

Sequence tag IST11858E10HMF1
Sequence
ACATAAGGAGCAATCAAAATGTTATCATGTGTAACCAGTCTACAGGATTCAGAGCCATTCTCTTCCGTTCTTTTTTTTTT
C
Sequence Type genomic DNA
Unitrap ID UNI32122

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 169574761..169574840 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047907 (Tshz2) NP_536703 teashirt zinc finger family member 2 Gene [Source:MGI (curated);Acc:Tshz2-002]

 
Come back to gene ENSMUSG00000047907


For any suggestions or comments, please send an email to unitrap@crg.es