Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST2795-NL
Clone ID PST2795-NL
Vector U3NeoSV1
Project escells

Sequence tag PST2795-NL
Sequence
ATGTGTGGTACATATGTGGAGGTCAGAGGACAACTTTCGAGTCATGTACACTGTGTGAATGGCAGGGAATTAAACTCAGG
CTGTCAGTCCACAAGAGCCTTAGCTCACCAGGC
Sequence Type genomic DNA
Unitrap ID UNI14848

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103773054..103773165 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034187 (Nsf) NM_008740 N-ethylmaleimide sensitive fusion protein Gene [Source:MGI (curated);Acc:Nsf-001]

 
Come back to gene ENSMUSG00000034187


For any suggestions or comments, please send an email to unitrap@crg.es