Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14121F8
Clone ID IST14121F8
Vector VICTR74
Project tigm

Sequence tag IST14121F8HMR1
Sequence
AATGTTTGAACATTTCAACATTTTTGGTTATAAATTAGGGCATGCAAGACAAGGTTGAAAAAGTCCAGTAAGTCACAGTG
GGTGTGGCCCCAAGACCCATTAGATTCATACTCCCTCAAAATGAAGCAAATAAAAGCCTTGAAAAACAAGCCGGGCCTGG
TGGCACACGCCTTTAATCCCAGCACTCGCGAGGCAGAGGCAGGCANATTTCTGAGTTGAGGCAGCCTGGTCTACAAAGTG
AGTTCCAGGACAGCCAGGGCTATNCNNANAAACCCTGTCTCNAAAAACCAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84846106..84846408 291
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST14121F8HMF2
Sequence
CCTAACTTTCACATTAAGTACAAATGTTTAACATATATAACATGTTTTGCCTTGATATATGAAATCNTATGACATCACCT
GACAGGAAACTTAAGTTTATTTGAACAACAATCAGCCTAAGGTAGGCCTAGCACATGATCAGGATAGTGCAGGGAAACCC
AAAGAAGTGCTTCTGANTATAANCCNAGAGACCTCGAAATANCNNCTTTGTTCTGTATCTCATGGGCTTTAACNATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 113022597..113022832 220
 
EST/CDNA Est Name
  BY016448.1 - BY194078.1 - BQ570391.1


Sequence tag IST14121F8BBF1
Sequence
ATTTCCNGGCACCTATCTTTGGATTTAAAAAAAAAATCCAATTTAAATTCCNTTACAAAAAATTTAAATCCNACTTTAAA
TTTTTAAATCAAATTTAGGAAAAAAAANNTTAANNTGTTTTTNANTGNNNATGTGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene BY016448.1 - BY194078.1 - BQ570391.1


For any suggestions or comments, please send an email to unitrap@crg.es