Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14454D7
Clone ID IST14454D7
Vector VICTR74
Project tigm

Sequence tag IST14454D7HMF2
Sequence
GTATAGCCCTGGCTGTCCTGGAACTCACTCTGTAA
Sequence Type genomic DNA
Unitrap ID UNI16231 UNI34647 UNI34648

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6269735..6269769 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 19587013..19587047 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46409541..46409575 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 67681235..67681269 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 51829271..51829305 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 17320099..17320133 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055137 (5033411D12Rik) NM_138654 RIKEN cDNA 5033411D12 gene Gene [Source:MGI Symbol;Acc:MGI:1923221]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 60070118..60070152 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3254820..3254854 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020451 (Limk2) NM_001034030 LIM motif-containing protein kinase 2 Gene [Source:MGI (curated);Acc:Limk2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58437514..58437548 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12487356..12487390 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75474448..75474482 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72368078..72368112 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031860 (Pbx4) NM_001024954 pre-B-cell leukemia homeobox 4 Gene [Source:MGI Symbol;Acc:MGI:1931321]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 17348435..17348469 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 6298432..6298466 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3538035..3538069 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 44046875..44046909 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 93550259..93550293 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 14817314..14817348 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 73631396..73631430 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 94520718..94520752 35
NO GENE  


Sequence tag IST14454D7BBF1
Sequence
NTATAGCCCTGGCTGTCCTGGAACTCACTCTGTANACCAGGCCAGCCTCGGACTCANAAATCCACCTGCCTCTGCCTCCC
GAGTGCTGGGATTAAAGGCATGCGCCATAGGGTTTTATTGCTGTAAAAAGATACCATGTCCACAGCAACTCTTATAACAG
AAAAAACATTTAACTGGGGCTGGCTTACAGTTTCAGAGGTTCAGTTCATTATCATCATGGTGAGAAGCATGGCAGCGTGT
AGGTAGACATGGTGATAGAGGAGCTGANAGTTCTACATCTTGATCTACAGGANNCANAAAGGGACTATGTGTCNCACCNA
ACACTGCCTGAGCATANATATGATTCANNGCCNNTCTCCNCANTNNNNNNCTTCCTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031860


For any suggestions or comments, please send an email to unitrap@crg.es