Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10916H10
Clone ID IST10916H10
Vector VICTR76
Project tigm

Sequence tag IST10916H10HMF1
Sequence
CTGTGTCTACACGTCTTTTTTTTTTTTTTTTTTTTNTTN

Sequence Type genomic DNA
Unitrap ID UNI18231

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114394392..114394429 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031953 (Tmem170) NM_025781 transmembrane protein 170 Gene [Source:MGI Symbol;Acc:MGI:106426]


Sequence tag IST10916H10HMR1
Sequence
ACAGTATCAAGGCAGCTCCAGGAGAGGTAGGAAGGAAGTTCTCATCTTAACCCGACTGCTGGTTAGCACCCAGATCTGAN
NTGCAGCCTCNNNAATGGAGAAGCAAACAGCTGTTTCAATGGTCTAGCCTGTGGAACTGTGTTACAGCAGCCTGGCTGTG
ACAAACACCCACACATTCACCCATGCTAACTCCCTGCAGCATAGCACCTACCCAAGGGCCACCAGGATCCGGCCAGCACC
ATTCTGAGCAGCAGCACACAGGGACAATCCACCCCACCTATCACCCCGAACCCCCAAATCCCGCCTACCCACCACCACCC
AAAGCCATATGTTAGCTACTTGAGTGTCCACATATANTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114394426..114394784 347
 
EST/CDNA Est Name
  CJ177617.1 - BY327441.1 - BY349153.1 - BY348570.1 - BY348569.1


Sequence tag IST10916H10BBF1
Sequence
CTGTGTCTACACGTCTTTTTTTTTTTTTTTTTTTTN

Sequence Type genomic DNA
Unitrap ID UNI18231

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114394395..114394429 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031953 (Tmem170) NM_025781 transmembrane protein 170 Gene [Source:MGI Symbol;Acc:MGI:106426]

 
Come back to gene ENSMUSG00000031953


For any suggestions or comments, please send an email to unitrap@crg.es