Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XS0985
Clone ID XS0985
Vector pGT0lxf
Project sanger

Sequence tag XS0985
Sequence
ACTATGAATGTCATGGCATAGGCTGGGCCCCCCATAACCATCCTCCTTGTGTGATGGCATGCAGCACATTCTGTCGGCTC
CNCCCTCTGCGACTCCTGATCCCGATCCCGATCCTCCCTCTTCCTTACATCCTGCCCTAGGCCGGCCCTCCCCCAGCTCG
GGAAGAATGTGCCACCAGCTGTTCTCCTCCCGGGAGCACTTCGCCCAGAAGTGAGGAACTTGGAGGAAGGAGAGACAAAG
GCTGTGGTTGGGACAGAGGAGGTCCGAGACGCGGACAAAAGGTGCGGAGGAGCAGCAGCGACCGGGGGATGGCAGAGCGG
CGGCTCCGCGGGCTGGAGTCGCCCCGAGGCGCACCGTGACACGCGTGGCTTCCCGGGACCTGCCGCTGCGCTGACTTCCG
CGACTGGAGCCGTGCCGGGAAGGTGCGGGCGCCGGAACAATGGACAGCTTCTTTCCCGAGGGAGCACGGGTCTGGCTAAG
AGAAAATGGCCAGCATTTTCCGAGTACTGTAAATTCCTGTGCAGAAGGCGTCGTGGTCTTCCAGACAGACTATGGGCAG
Sequence Type mRNA
Unitrap ID UNI2514

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25552456..25596279 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]

 
Come back to gene ENSMUSG00000022272


For any suggestions or comments, please send an email to unitrap@crg.es