Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14378C9
Clone ID IST14378C9
Vector VICTR74
Project tigm

Sequence tag IST14378C9HMF1
Sequence
TCTTTTGCTCACTGATGGGAAACAACAAACATAAAACTCTTGACTCGAACATTTGGGGTGCTCCGCATTCCTAAACTCCT
CGCCCAGCTCATTTTGCGATGGGCAGCCGGGTGTGGACAGGGAAGTCAGGGGAAGGTAAGTCGTGCGGGCACTTGGAGAA
GTTTCAAGGGACACTAGCTCAAGATGGAAACCGCAGCCCTGGCCCGCTCAAGACCAGCTCCAGCGCCTGCTAGGAAGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 81214567..81214804 238
NO GENE  


Sequence tag IST14378C9HMR1
Sequence
NAGGAAGCAATACTCCTTTGTAGTGGAAAATGTAACTGAGCTGATTGATTATTATTTGAGAAACTTGAAAGGGTTTTTTA
TATCTAGCATTGCAGGTTCTCTGAAAACAGCATTTTGAGCTCAAGATTAAAAGTGACTGGATAAGATTGCCTCANTATAC
AGAACATCGAGCTAAACTAACAAGTAAATTCATCATTAGTGATGATGCCATGGGTATTGCTATTAGGATTCAATTGTTAA
TGTCAGTTGTTACTCGAAATTGTTTGTTCTTGAGTANTAATCNANATTTAGTATATTGNNNGANCNNCNNANNTN
Sequence Type genomic DNA
Unitrap ID UNI2657

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6240059..6240355 289
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006740 (Kif5b) NM_008448 kinesin family member 5B Gene [Source:MGI Symbol;Acc:MGI:1098268]

 
Come back to gene ENSMUSG00000006740


For any suggestions or comments, please send an email to unitrap@crg.es