Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14557E9
Clone ID IST14557E9
Vector VICTR74
Project tigm

Sequence tag IST14557E9HMR1
Sequence
TTATAGGTTAATNGTGGTAGGAAATGANATTTTAAATTTAANAAGAAAAACATTTTACAAACCTTTANACCTGCAGGGTT
TTGCTTTTTAAGTACAAAATGAGGAAGTTGGATCTTTGATTTTTAAGGTATCTTTGAGCATTAGAATTGTGGGTCAATTT
TCTTTTTTGTAATAGTGTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI11537

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29139496..29139687 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024006 (Stk38) NM_134115 serine/threonine kinase 38 Gene [Source:MGI (curated);Acc:Stk38-001]


Sequence tag IST14557E9BBF1
Sequence
ATACTTGGCTTATTGTTAGACAAACTAAACTGCTCCAGCATAAGTGACCGAATTCAAAAGTTTGTCCTTAGCCAGCTTTC
TTTTGTGTAAAATCAATGAATTTACTTCCTCCACCTCCCTCCCTAGTGGAATTTTTTTTGATATGGTGTGACTGCGTANC
CCACACTGGCCTANAACTCACTATCCTTCACCACCCAAATGCTGTGGTTACAGGTGTGTACCTCCATGCCTAATGGGTTC
TGTCCTTTTACCCCAACAGGAAGTANAGCAAAATTCAGGAGGANCANAAAGCCATTTTCTTTTTTTTTCNANANAGGGTT
TCTCTGTGTANGCCTGGCTGTCCNGGAACNNANTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29139685..29140033 329
 
EST/CDNA Est Name
  CF898026.1 - BF730918.1 - CF162146.1 - CA879214.1 - BB853315.1 - CD543509.1 - CD554119.1 - AW822635.1 - BY255214.1 - BY028778.1 - BB854160.1 - BB852438.1 - BY173763.1 - BY059482.1 - CD540693.1 - BY788050.1 - BB658467.1 - BB472589.2 - BY789770.1 - BE375812

 
Come back to gene CF898026.1 - BF730918.1 - CF162146.1 - CA879214.1 - BB853315.1 - CD543509.1 - CD554119.1 - AW822635.1 - BY255214.1 - BY028778.1 - BB854160.1 - BB852438.1 - BY173763.1 - BY059482.1 - CD540693.1 - BY788050.1 - BB658467.1 - BB472589.2 - BY789770.1 - BE375812


For any suggestions or comments, please send an email to unitrap@crg.es