Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12044B7
Clone ID IST12044B7
Vector VICTR76
Project tigm

Sequence tag IST12044B7BBF1
Sequence
GATGTGACTTTCACAATGGGTCAGGTGGTATCTCGGGAAGGACAAGGGAGAAGAGAAACTCTATTCCGATGTATCAGAAG
TATGCCTTCTGATCCTGACCGTGCCTACAATAGCTGCTACAGTGCAGGTGAGAACTGTGGGCTCCGTGGAGTGTTGATAT
GAGGTAGCAGAGCTGACTTGGAGTGGGGAGTTAGACCAGAGAGTTGGGAACGGGGGTGGAGAGGCAAATCTGAAGACTCA
AGAACAAGATGCCNAAGTCCTTGCAGGGAGAAAAGGCACCCGCCTATGAACAACTAGGTTCGTGCCTATAATCCCACATA
TGAAGCCCATGTGATAGGTTAGCCTAAAGTTCAAGGTCAGCCTAGGCTACAGAGTGAGACTGCCTTCAAAATTCAACAAA
GCCNGTGAGACCGCTCACTTANGAAAGTAACTTGCTCCATCCCTTACATCTCACCTCCTGGGTTTGATTCCNANAACCCA
CANAGCNANNNGAANGNACCNACTCTNNAGCTGTCTTCTGANCTCCNCACATGCNCATGTTCCCNNACNAAAAAACTGAA
AAN
Sequence Type genomic DNA
Unitrap ID UNI30878

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69496922..69497482 518
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]


Sequence tag IST12044B7HMF1
Sequence
GATGTGACTTTCACAATGGGTCNGGTGGTATCTCGGGAAGGACAAGGGAGAAGAGAAACTCTATTCCGATGTATCAGAAG
TATGCCTTCTGATCCTGACCGTGCCTACAATAGCTGCTACAGTGCAGGTGAGAACTGTGGGCTCCGTGGAGTGTTGATAT
GAGGTAGCAGAGCTGACTTGGAGTGGGGAGTTAGACCAGAGAGTTGGGAACGGGGGTGGAGAGGCAAATCTGAAGACTCA
AGAACAAGATGCCAAAGTCCTTGCAGGGAGAAAAGGCACCCGCCTATGAACAACTAGGTTCGTGCCTATAATCCCACATA
TGAAGCCCATGTGATAGGTTAGCCTAAAGTTCAAGGTCAGCCTANGCTACAGAGTGAGACTGCCTTCAAAATTCAACAAA
GCCNGTGAGACCGCTCACTTANGANAGTAACTTGCTCCATCCCTTACATCTCACCTCCTGGGTTTGANTCCGAGAACCCA
CAGANCAAANGGAANGNNCCNACTCTCAAGCTGTCNTCTGNNNTCCNCACNTGCNCNTGNNCCCCAACAAAAAANTGAAA
AN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000018752


For any suggestions or comments, please send an email to unitrap@crg.es