Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10327F11
Clone ID IST10327F11
Vector VICTR76
Project tigm

Sequence tag IST10327F11HMF2
Sequence
GTAGTAAGGTTCTAATCCTTANGTATATTCATGAATAGTTATTTANTAATAGGGATCAATTTAAATTTACACTAAGTAGT
CTAAGAACATAATGGAATAAACATATAAGAAGGTACATTTACTAAAATGCTCAAGAAGTGTCCCTGCTTTTCTCCCACAG
AAGTGAGTCAACGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 36907262..36907435 170
NO GENE  


Sequence tag IST10327F11BBF1
Sequence
CCACATGCTTCTGAAATTGGATGTCACTTTGTCGTGCCTCCTATAACCAGCACAGCTGCTGTAACCCCATTTACCGCATA
CTTAACTTTAAACCGGGCACCATGAAGGCACTTTACTTGTGGTCTTTCATTTGCTTCTCCAAATCCAACAGGGTAGGTGC
TAGCACTCACTCAAACTCCAAGAGGTTAAGCAATTTGCCCAAGGTCACACAGCTAACAAGTAACAAGGTCAAAAATTTCA
TTTGTTTTGGGCACTTTGCATGTGAGTCTCTGTAAGTAGCTGACAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI19923

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 61391138..61391428 291
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058806 (Col13a1) NM_007731 collagen, type XIII, alpha 1 Gene [Source:MGI (curated);Acc:Col13a1-005]

 
Come back to gene ENSMUSG00000058806


For any suggestions or comments, please send an email to unitrap@crg.es