Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10390A3
Clone ID IST10390A3
Vector VICTR76
Project tigm

Sequence tag IST10390A3HMR1
Sequence
TCCTCTGCCNATATCATAGCAAACATTGAGGGAATTCTGAGTACCCAGGACATCCAGTCTGATTCATAGAGGGATATCAA
ACAATGTCTGCTTTAAAGAAAAGGTACTAGCCGTGCATGTCCCTGAAAGCCTGTAAGCTCAGACCTGGGAGGTGGAGGCA
GGAGGGCCAAGGTCATCCGTGTTTACAGAGCAGTCTGAAGGCCNNNANGGN
Sequence Type genomic DNA
Unitrap ID UNI5107

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154484279..154484481 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038467 (Chmp4b) NM_029362 chromatin modifying protein 4B Gene [Source:MGI (curated);Acc:Chmp4b-001]

 
Come back to gene ENSMUSG00000038467


For any suggestions or comments, please send an email to unitrap@crg.es