Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12852G4
Clone ID IST12852G4
Vector VICTR76
Project tigm

Sequence tag IST12852G4HMF1
Sequence
GGGAGGTAGGGGGAGGGGAGGGGTGTGTGGGAGGGAGGAGGGAAAGGGGGTGTTCTTGTCAGGACCCCTCAGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI34655

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92024703..92024779 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058318 (Phf21a) NM_138755 PHD finger protein 21A Gene [Source:MGI (curated);Acc:Phf21a-002]

 
Come back to gene ENSMUSG00000058318


For any suggestions or comments, please send an email to unitrap@crg.es