Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12414E5
Clone ID IST12414E5
Vector VICTR76
Project tigm

Sequence tag IST12414E5BBF1
Sequence
CTAGGATTACAGGCTTGTGCCACTCTGCCCTGTTTCTCCTCTTCCTCCTCTTCCTCTTCCTCCTCTTACCCCTTCTCCTC
CTCCTCAGCATCTTCATCATCTAATTTCATCATTTTCCTTTTCCGCCCTCCAACCCTTTACACATACCCACTCTCCTTGC
TCCCTCTCAAAATTATGGTCTCTTCTTTTAGCTGTTATTGTTTTACACATGCACGCGCGCGCACACACACACACACACAC
ACACACACTNTA
Sequence Type genomic DNA
Unitrap ID UNI16140

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4896202..4896449 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006464 (Bbs1) NM_001033128 Bardet-Biedl syndrome 1 (human) Gene [Source:MGI Symbol;Acc:MGI:1277215]

 
Come back to gene ENSMUSG00000006464


For any suggestions or comments, please send an email to unitrap@crg.es