Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST3269-NL
Clone ID PST3269-NL
Vector U3NeoSV1
Project escells

Sequence tag PST3269-NL
Sequence
ATGTTAGGCCCGTGGAGGTGGAGGGAAAGTGGGGCCCAAGGCCAGGCTTTGTTGAAGCCCAGACGCGGCTCGGGGCCCTG
GGAAAGATGGCTTCCCACAAAAGACACCTGGGGGCTGGCAAGTGGGCAGGGAGGCCCCAAGACCTGGGACGCCCTCCCGG
CAAAGAACCAAAATGCCTCACTCTCTGGAGTCACACCTCAGCTGCTCCAATGGAGGTAAGAGAGCATCTCTAAGGGGACG
AGGACAGAGCTAGCACCAAGGCAGGGAGAAAAGGGCAGGGCTAAGGGGTCACTCATTCAATC
Sequence Type genomic DNA
Unitrap ID UNI8978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 141151057..142408929 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040606 (9030409G11Rik) NP_001103155 RIKEN cDNA 9030409G11 gene Gene [Source:MGI Symbol;Acc:MGI:1918779]

 
Come back to gene ENSMUSG00000040606


For any suggestions or comments, please send an email to unitrap@crg.es