Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10832B8
Clone ID IST10832B8
Vector VICTR76
Project tigm

Sequence tag IST10832B8BBF1
Sequence
GGTTAACGGGAGAATCTGCAAGACAGGGTAGACTGAGAGAAGACTATCCCGACATCTTCCGAAAAACCGTTCACAGAGCT
GAGCGGTGTCTCACTAGCTCCGTCCCGGAAGTGGTCCTTCATCAGCTCCGGGTGCCCGGAGCAAAATCTCCGAACTCCCG
GAAGTCGCTCTGCGGCTACTCGCCCGGCCGGGGCCCGTACAAGCTCCAGCTTCGGGCGAACCCGGCCCGGGCATCGTCAT
GACCAGCGAACTAGACATTTTCGTGGGGAACACGACCCTTATAGATGAAGACGTGTATCGCCTCTGGCTGGATGGTTACT
CAGGTCTGTGAGCCGCCCTCCCGGGAAGCTGTTGTTGGGGATCGGGAAGANGGGGCGTGGCTAGGATTTANGCTTGGTTT
ANGGAAGTGGACNGACTGNGGGAAGTCGGGGAAGTGTAN
Sequence Type genomic DNA
Unitrap ID UNI34657

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5460456..5460893 428
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024911 (Fibp) NP_067413 fibroblast growth factor (acidic) intracellular binding protein Gene [Source:MGI Symbol;Acc:MGI:1926233]

 
Come back to gene ENSMUSG00000024911


For any suggestions or comments, please send an email to unitrap@crg.es