Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15087F10
Clone ID IST15087F10
Vector VICTR80
Project tigm

Sequence tag IST15087F10HMF1
Sequence
AGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCGAAC
Sequence Type genomic DNA
Unitrap ID UNI14366 UNI25205 UNI32250 UNI33577 UNI34659 UNI34660 UNI34661

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 6179754..6179792 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4722443..4722481 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4214721..4214759 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 18336977..18337015 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8283238..8283276 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052551 (Adarb2) NP_443209 adenosine deaminase, RNA-specific, B2 Gene [Source:MGI Symbol;Acc:MGI:2151118]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35089915..35089953 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041471 (3110001K24Rik) NM_029389 RIKEN cDNA 3110001K24 gene Gene [Source:MGI Symbol;Acc:MGI:1922948]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 34568157..34568195 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038879 (Npal2) NM_145469 NIPA-like domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1924488]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 15835071..15835109 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022672 (Prkdc) NM_011159 protein kinase, DNA activated, catalytic polypeptide Gene [Source:MGI Symbol;Acc:MGI:104779]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 7262593..7262631 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073470 (AC122413.4-202) NM_001033442 Putative uncharacterized proteinGene model 1604, (NCBI) ; [Source:UniProtKB/TrEMBL;Acc:Q3TRG0]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 4079945..4079983 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 7202505..7202543 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 22985443..22985481 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 36328018..36328056 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 59552163..59552201 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 23246921..23246959 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057541 (Pus7) NP_848490 pseudouridylate synthase 7 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Pus7-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 4678885..4678923 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3497952..3497990 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053338 (CAAA01179078.1.1.20098) NM_177363  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 10847312..10847350 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21170176..21170214 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12411215..12411253 39
NO GENE  

 
Come back to gene ENSMUSG00000053338


For any suggestions or comments, please send an email to unitrap@crg.es