Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11714F6
Clone ID IST11714F6
Vector VICTR76
Project tigm

Sequence tag IST11714F6BBF1
Sequence
NAAGGTATCCGTCCCCTTTACCCACCAAATGGTTTTAGGATTAATTTTCACGAACAGCAAAAGAGCTACGGGCACCTACC
TGTCTCAGCCTGAGGCTGTGGCAACTCCTGCTCTGTAGCAGGGACGGTTTCTGTGGCTTCACCGGGCATTTCTGAAGGGA
ATAAAACGGAGGCCCCGAATTAACTCGGGCGGATTCNCCTGCCTANCCCAAGGATTCCGCCTAGTCAAGTATTCCNAAAA
CAAACAAACNAACNAAACAAACCTGCATAAGGCCCATTAANAAAACAAATTCCCGAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127473395..127473694 288
NO GENE  


Sequence tag IST11714F6HMR1
Sequence
TTTCTGCCTTTTGTAGTTTACTGACTTTAAAGAAAAATTTGAAATGGGATTGTAGCTTTAGTAAGAGATCTAATTGTTAC
CTTGCTTAGGGGAAGGGGACTCTTCGGGGAAGAAAGTAAAAGATTGTATCTTTGAGATTTATATGCGGGTTCCCTAGGCT
GCTCTGTGAATACACCAGCTGCTTGAAAAGCTCTTCTGTGGAATCTACNCNTAGGAAACTCGAGTAGGGAAGGGGCTGGG
TCCTTCTGGTCTGTTGTAACTGGGCGGCTCANGCANGCCN
Sequence Type genomic DNA
Unitrap ID UNI5812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127473693..127473971 271
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061315 (Naca) NM_013608 nascent polypeptide-associated complex alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:106095]


Sequence tag IST11714F6HMF1
Sequence
AAAGGTATCCGTCCCCTTTACCCACCAAATGGTTTTAGGATTAATTTTCACGAACAGCAAAAGAGCTACGGGCACCTACC
TGTCTCAGCCTGAGGCTGTGGCAACTCCTGCTCTGTANCAGGGACGGTTTCTGTGGCTTCNCCGGGCATTTCTGAAGGGA
ATAAAACGGAGGCCCCGAATTAACTCGGGCGGATTCACCTGCCTANCCCAAGGATTCCGCCTANTCAAGTATTCCNAAAA
CAAACAAACNNNCNAAACANACCTGCATAAGGCCCATTAANAAAACAAATTCCCGAGGATCCGGACAACCTCCCCAAAGC
ANCTGGAAACGGGGTCAAACTACNCCACGACCCTGGGACGCCTGCTCANANGATCTGACCTCNCNGANCCGCTTCACTTA
NCANAGAGCTGACTTCGCCCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000061315


For any suggestions or comments, please send an email to unitrap@crg.es