Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10762F10
Clone ID IST10762F10
Vector VICTR76
Project tigm

Sequence tag IST10762F10BBF1
Sequence
ATGCGGTCCCACTGGGTGGGGAGGAGTAGGGGTGCCTTTGTGGGTTTCCACCCACCCTGGGCATCTGGCCCAGGCTCAGT
GTTCCAGCCATAGCTGCTGAGGCAGGCCAGGGCGAGGCAGTGCTCACCTCCCTTGGTGATAGTGGGTGGTTGGATGTAGG
GAGTTTCACTTTGCGGCTGGGTGGGGTCTGTGGGACTAAGGCCCAGCTGGCAATCTGGGGACACTTTTCTAGGCTGTCAC
CGTAACTTACCTGTCTGGTGCTTTCAGGCTCTGTCTCTGGTCCCCAGTATCCCCGGCAGCCCATCTGATAAGGGCTTTCC
CATTATCTGTTCATGGTATCCCTCCCCTCCCCCACACCTCATCAGGTCGCGCANCATGGTCAGGGCTGCTTCAGTTGTAA
TGCTCANGANTGGTGGAAGGGAGACTTGAGAGACATGTTGGGGTACCCTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI15218

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27203905..27204358 448
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042644 (Itpr3) NM_080553 inositol 1,4,5-triphosphate receptor 3 Gene [Source:MGI (curated);Acc:Itpr3-001]


Sequence tag IST10762F10HMR1
Sequence
NNACTGTNAAGCTACCTTCCCCTCTCTGGTCNTACCCTTCNNNNANGGTCCCTCCGTCTGANGTCCCACCGTGCACCCTG
GTCTTATTGTCNNTTCCCCTCATCTGCTCTGAANAGCTTCACCCAAAGGCNGANCCNCCTGGGCCACACANCTNNTCANA
CNCATGACGGCCCTGACCCCANTCAGGCTCANCAAANCTTCTGTGGGATCCATGATATGCTGGGTGTGGCCTANTCTCAG
GGAGCCCATGCTCACCCTGCTAAATGCCCAGGGCGTANGATCNTCNGGTCTACACCTGCCCACCANGCCCAANCCACACA
NAANCCNTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000042644


For any suggestions or comments, please send an email to unitrap@crg.es