Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14745F7
Clone ID IST14745F7
Vector VICTR76
Project tigm

Sequence tag IST14745F7HMR1
Sequence
GTGGCGGTCACAGTTGTTGTGGAAGCCTTAGCTGCTCCGCTGGATTGGTCC
Sequence Type genomic DNA
Unitrap ID UNI25300

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154713859..154713908 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074656 (Eif2s2) NM_026030 eukaryotic translation initiation factor 2, subunit 2 (beta) Gene [Source:MGI (curated);Acc:Eif2s2-001]


Sequence tag IST14745F7HMF2
Sequence
ATTGTANCANCCTGNCAGTAGGAACCTAGGGAGCTGAGTGGAGAGTGTGAAGTTCTGAGTCAGTCTCCATAAGATAAAAA
CAGGTCCGCCATTGCCTGCCAGTGCACCGGCCAGGCTGCTGGGGCAGAGGCACATGCGCAGGAAAGTGTCAGGTTTTGTT
TGTGTGTGTGTCTGTGTGTTTTCAGATTTATTTTTATGTATGTGAGTGCACTGTAGCTGTACAGATGGTTGTGAGCCTTC
NNGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87945744..87945983 234
 
EST/CDNA Est Name
  BY329660.1 - AA098549.1


Sequence tag IST14745F7BBF1
Sequence
NGCNNTGNNNCNNCCTGCCNNTAGGAACCTANGGAGCTGAGTGGAGAGTGTGAAGTTCTGAGTCAGTCTCCATAAGATAA
AAACAGGTCCGCCATTGCCTGCCAGTGCACCGGCCAGGCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87945754..87945860 101
NO GENE  

 
Come back to gene BY329660.1 - AA098549.1


For any suggestions or comments, please send an email to unitrap@crg.es