Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XS0888
Clone ID XS0888
Vector pGT0lxf
Project sanger

Sequence tag XS0888
Sequence
TAATGGGAAAAGTTTTGGCAGGAGCTGGGGGATTCTGCGGAGCCTGCGGGACGGCGGCAGCGGCGCGAGAGGCGGCCGGG
ACAGTGCTGTGCAGCGGTGTGGGTATGCGCATGGGACTCACTCAGAGGCTCCTGCTCACTGACAGATGAAGACAAACCCA
CGGTAAAGGCAGTCCATCTGCGCTCAGACCCAGATGGTGGCAGAGCTATGACCAGGCCTGCAGGCGCCACGCCAAGTGGG
GGTCAGTCATGGAACAGCCACAGGAGGAGACCCCTGAGGCCCGGGAAGAGGAGAAAGAGGAAGTGGCCATGGGTGACGGA
GCCCCGGAGCTCAATGGGGGACCAGAACACACGCTTCCTTCCAGCAGCTGTGCAG
Sequence Type mRNA
Unitrap ID UNI2521

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28369726..28423412 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002250 (Ppard) NM_011145 peroxisome proliferator activator receptor delta Gene [Source:MGI (curated);Acc:Ppard-001]

 
Come back to gene ENSMUSG00000002250


For any suggestions or comments, please send an email to unitrap@crg.es