Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11566G7
Clone ID IST11566G7
Vector VICTR76
Project tigm

Sequence tag IST11566G7HMR1
Sequence
GCTTCATGGACCNNNCTNANTNNCNNNNGGTAGNNNNNNNNGNNCTGAAAGCAAAACAGAGGTTAGTAGTTTCTCTTTAG
CTTACGTGTTGTGGTGACCCCATGACACTGGAAGTACAGCTTTCAGGGGGTGCTTTATAGGCATAAGCCCAGCTGTTATT
TGACCTCAAATCCATACTCACTTACCCCTGGCATGATTATCTTCTCGATGTCTTTGATTATGTCCTCGTATGTTTCTGGC
TCCTGGGGGGCAGTGGCAGGGATCAGGGGCCGAAGATAGCCAGGCTCCACATCAGGGNNNNCTNANNNNNNNGTGNTGNN
NNNNNNATAGTCNNCTATATAATCNACCATCTCCTTGCCTCTCCTCCGGAATTNACGGNAANTCCNTGTTGAAAACC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11780304..11780654 253


Sequence tag IST11566G7BBF1
Sequence
AAGCTCTNATGGGANAGTAAAGGATANAGCCNAACTACATAGGCAGTGCAAGGGCTTTCTCCAAGGCCTCCAAGACCAGT
ATTTGCATCACCATACAGGGTTCCTAGAGGGTTATTCTTTGATAGCACGAAAAAATAAGCTCCTANTGGTCNATTGCAAG
CAGTTTAATTAATTACCCTAAATAAAGGTACTTGCATCGTTCTTANATCTGT
Sequence Type genomic DNA
Unitrap ID UNI26234

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11780054..11780264 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020182 (Ddc) NM_016672 dopa decarboxylase Gene [Source:MGI (curated);Acc:Ddc-001]

 
Come back to gene ENSMUSG00000020182


For any suggestions or comments, please send an email to unitrap@crg.es