Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11042E1
Clone ID IST11042E1
Vector VICTR76
Project tigm

Sequence tag IST11042E1HMF1
Sequence
GGCCATTATAAAGAGAATTGGAGATAGGAGGGTGGAGGGTGCAGAGGAATAGCCTGATGTGAGCAGTTTGAGGTCATGAA
GTCCCAGCCTGTGCTGCCAGTGAGGGCCATGTCTGGGTTGGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30448667..30448790 124
NO GENE  


Sequence tag IST11042E1HMR1
Sequence
NCATTTGGCTTCTCGTTTCTCTCTGGTCTCTCCACCACATACTTGTATATTGCAGTGGCTCCTGCTATGAAAGGGCCTCC
TGGCTGGCTGGCCTCTGGGTCAAAATGTATTATTTTACAACTGAATTTTTAATAGTTAAATAATTTTGAAAGATTTAGTA
ATCAGGGCAAGTGAGGTAGCTTTTTGATAGAAGTGCTAGCTTCAAAAACCTGATACCTGAGTTTGGTCCCCANACN
Sequence Type genomic DNA
Unitrap ID UNI14329

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30448429..30448662 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039697 (Ncoa7) NM_172495 nuclear receptor coactivator 7 Gene [Source:MGI Symbol;Acc:MGI:2444847]


Sequence tag IST11042E1BBF1
Sequence
GGCCATTATAAAGAGAATTGGAGATAGGAGGGTGGAGGGTGCAGAGGAATAGCCTGATGTGAGCAGTTTGAGGTCATGAA
GTCCCAGCCTGTGCTGCCAGTGAGGGCCATGTCTGGGTTGGTGGCCATGCAGCAGCAGGGATCTGTGTTGATGTCCATGT
CTCCTATTAACAATAAAGATCACGTGGATATCCCTGGTCTGGACTACCTCCTGGGACCATATTGATATCCAGGGGCTGTG
CAGAGCTGGCCTCACTCTTTGCTGGCTTCAACACTTAAGAAAGTGGGCCCTGTACTTCAACTTGGAAGCACAGTAGAGCT
GGCTCTGATGGTGTGGGTGAGGGGAATCCAGCCCCATGGGCATGAGAGCAGGAGAGCTGGTCTTGCCCCTTTCCAGATAT
GGCATTANGTGAGCCTGGGCAGTGCTGGAGAGTTNACCCTGGTGGTGTGGGTATGGGANANCTGATGTAAGANTCTGGTG
ANCCTTANCTCACCGGANAACCCCCACCCCCANCCCN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30448667..30449182 498
 
EST/CDNA Est Name
  CD549846.1 - BU917962.1 - BY755707.1 - BB870337.1 - BY734504.1

 
Come back to gene CD549846.1 - BU917962.1 - BY755707.1 - BB870337.1 - BY734504.1


For any suggestions or comments, please send an email to unitrap@crg.es