Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10746E3
Clone ID IST10746E3
Vector VICTR76
Project tigm

Sequence tag IST10746E3HMF1
Sequence
AGAATTAATANTATCTGAGGGATGAACAATTTAAGCAATTGCGAGCTCANAGATATGGCATTGACTATTAATATACAAAT
TAAGGTTTGATTGTTCAGCATTTTAAAACACCATCTACAGCACACAACTAGATCATCTGTGCTGGAACAGGGGAAACTGT
GTCTTAAGACTCCGCCCCACAGAAGCTAGTTGGGCCCACGTGGGCCAACGATCGGCTGGGAGGATGANAAAAATGACTTT
ACAATAATGTTTTCTTTTTGGA

Sequence Type genomic DNA
Unitrap ID UNI15588 UNI15589 UNI30509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 84779933..84780193 255
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 29592561..29592821 255
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41654451..41654711 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039431 (Mtmr7) NM_001040699 myotubularin related protein 7 Gene [Source:MGI Symbol;Acc:MGI:1891693]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115776707..115776967 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030321 (BC060267) NP_001103976  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136939802..136940062 255
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52920159..52920419 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 10809799..10810059 255
NO GENE  


Sequence tag IST10746E3BBF1
Sequence
AGAATTAATAGTATCTGAGGGATGAACAATTTAAGCAATTGCGAGCTCAGAGATATGGCATTGACTATTAATATACAAAT
TAAGGTTTGATTGTTCAGCATTTTAAAACACCATCTACAGCACACAACTAGATCATCTGTGCTGGAACAGGGGAAACTGT
GTCTTAAGACTCCGCCCCACAGAAGCTAGTTGGGCCCACGTGGGCCAACGATCGGCTGGGAGGATGAGAAAAATGACTTT
ACAATAATGTTTTCTTTTTGGCCNAAGAATTGTTTTGGGCACAACCAATTTTTAATTACCAATTAATAACAATTATAAAA
GCTTTATTTTTTGTAGAAACTTTTGTAGTAAACTAAAACCCTAAGTAATAAAAGGATATTGTCTCTGAATCTTTTGGGTG
AGAGCAAGGATTTAAGGTAAACTTTAAGAAGCATTAGTTAATAAAATACTTTTNACTTAAGAAACAATATACACTGAAAG
ANTAAAACTCTTGGCTTCTTGTATAGAANCAGAAACNATAAAATTTTTTCTNACATAATGTAAAGTNACNTN
Sequence Type genomic DNA
Unitrap ID UNI15588

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41654163..41654711 535
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039431 (Mtmr7) NM_001040699 myotubularin related protein 7 Gene [Source:MGI Symbol;Acc:MGI:1891693]

 
Come back to gene ENSMUSG00000039431


For any suggestions or comments, please send an email to unitrap@crg.es