Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST4921-NL
Clone ID PST4921-NL
Vector U3NeoSV1
Project escells

Sequence tag PST4921-NL
Sequence
CATGCTTAACTTAGATTAAAATAAAATTAAGTCAGAATGGAAGCAACTATAACTGCCTACACAACAACACAGGTTTTTTT
ATTAACC
Sequence Type genomic DNA
Unitrap ID UNI14877

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66796052..66796138 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036781 (Rps27l) NM_026467 ribosomal protein S27-like Gene [Source:MGI Symbol;Acc:MGI:1915191]

 
Come back to gene ENSMUSG00000036781


For any suggestions or comments, please send an email to unitrap@crg.es