Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12030E8
Clone ID IST12030E8
Vector VICTR76
Project tigm

Sequence tag IST12030E8BBF1
Sequence
GAGCTAGGCAGGTGACATAAAGGAGTGCTCTGTATTGACCCTGAAAGCAAGGAATACTTCTGCATGAGCAGCACCTTGTC
AGTTCAAGGATTCGGACCTGGAAGTAAGACAGTCCCAGAATGACCAAACCTTTTAAATCTGTAGTATTAAGAATTTTATT
TCTCTGTATCTCAAATTAATCCTCTAGTAGGCTGAGCCAGCCAGGAGGAATAAGCCCATAAGCAGCACTCCTCTGTGCCT
CTGCATCGGCTCCTGCATCCAAGTTCCTGCCCTGTTTGAGTCCCTGTTCTAACTTCCTTCAGGAATGGACTATCAGTATG
AACCTATAAGCCAAATAAACCCTTTCCTCCCAAGTTGCTTTGGCCTCAGTTTTTCNTCNCAGCAATAGAAATCCTAACTA
AGACCACTAAGGAATATTCTGAAAACATAGTAAAGAGAGCTGGGAACAGCTTTCTGTCNTACTGTGGCACAGCAAGTTTG
AGGAAGTATCTGANTTGAATTTCNNTCNTTTCATTCTACTGAATTGAGTTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI33482

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 115539987..115540521 521
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040282 (BC052040) NP_997147 Uncharacterized protein C15orf41 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q3U4G0]


Sequence tag IST12030E8HMF1
Sequence
AGCTAGGCAGGTGACATAAAGGAGTGCNNNGNATTGACCCNGANAGCAAGGAATACTTCTGCATGANCANCACCTTGTCN
NTTCAAGGATTCNGACCTGGANNNNNNACAGTCCCNNAATGACCAAACCTTTTAAATCTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040282


For any suggestions or comments, please send an email to unitrap@crg.es