Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13062E6
Clone ID IST13062E6
Vector VICTR76
Project tigm

Sequence tag IST13062E6HMF1
Sequence
ATACATAGTTTCTTAGTGTAAGCAGCCCTGGCTGTCTTGAAGATACTTTGTAGGCCTCAATCCTGTAAGAGCCTTCCTCT
GCTTTTCAAATGCTGGAATGAATGTTGTACCTCACTATGACCGGCTGAGATTCTCACCTTTTCTTTTCTCCCCTCCCCCT
TTCTTTTTATGATTCTAGCTTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 74916687..74916868 168
NO GENE  


Sequence tag IST13062E6HMR1
Sequence
TCCTGAATGTGGCCCTTTGCTGGGAGGTTCTTTCTGATAGGATTCTTTTGAACAAGGTGGGGGTGGGATGAGATTGANAG
TTTANGCTGAACTCTCCCAGTCACTTGACCTCTGCCCCTGTTTCAGAGTTTATACTGACTTGTAGGCATTCTCCATGGAG
CCAAGAGTTGAGGACTTGTTTACAATTGGATTCAAAGGCAATTGTTGAGTCCTTGTGTAGCCATGGATGCCTGTTACTAT
CTGGTGGGTGCANGGAATGCTTTGANATTTGTTATGGATGACNNNNAANGAATGTCTAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI5314

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38730195..38730497 285
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063972 (Nr6a1) NM_010264 nuclear receptor subfamily 6, group A, member 1 Gene [Source:MGI (curated);Acc:Nr6a1-001]

 
Come back to gene ENSMUSG00000063972


For any suggestions or comments, please send an email to unitrap@crg.es