Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0394
Clone ID GC0394
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0394
Sequence
ACATAGGTATCTCCTGCTTAGCACTCATTACACACTGCGCCCTGGAGTACCTCCGACAACTGTGAGGGGCTTCACCCTGC
AGCATTCTGCATTTCATTTCTCACATTTGTTCATCCAACGCCAGCTTGACTCGTTGTTCTCTCGATGACACCATCAGGGT
CCATTCCCTCTGGGCCGCCATGTTCTCTGTTGTTATCCTCGGAGCCGCCACACATAGATGCTAAAACCCACTTATCGCCC
GACTTCATAAGAAGCCCCCCCTCCCCTAAATTCATATCATCAAAGTTATCAACAATTTCATTCCAGTTGCTCTCGATGAC
ACCATCGGGGTCCATTCCCTCTGGGCCGCCATGTTCTCTGTTGTTATCAGCGGAGCCACCACACATGATCCGAAAACCCA
CTCATCGCCCGACTGAAAAG
Sequence Type mRNA
Unitrap ID UNI246

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 23107831..23110228 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022884 (Eif4a2) NM_013506 eukaryotic translation initiation factor 4B Gene [Source:MGI (curated);Acc:Eif4a2-002]

 
Come back to gene ENSMUSG00000022884


For any suggestions or comments, please send an email to unitrap@crg.es