Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10442F3
Clone ID IST10442F3
Vector VICTR76
Project tigm

Sequence tag IST10442F3HMR1
Sequence
GGCTATACAGAGAAACCCTGTCTTGAAAAACCNAAAAAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI5651 UNI34667 UNI34668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 3895206..3895260 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62309576..62309630 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70662129..70662183 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020817 (Rabep1) NM_019400 rabaptin, RAB GTPase binding effector protein 1 Gene [Source:MGI (curated);Acc:Rabep1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 21523975..21524029 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 75151221..75151275 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 20023257..20023311 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 10561197..10561251 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20160868..20160922 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041215 (Yeats2) NM_001033237 YEATS domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2447762]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 6571027..6571081 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 67925890..67925944 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 28759852..28759906 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 22588342..22588396 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51929009..51929063 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 55442579..55442633 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124139215..124139269 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 18327861..18327915 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26158808..26158862 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 59104750..59104804 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21945746..21945800 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 134154869..134154923 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059203 (Il1rapl2) NM_030688 interleukin 1 receptor accessory protein-like 2 Gene [Source:MGI (curated);Acc:Il1rapl2-001]


Sequence tag IST10442F3BBF1
Sequence
GCCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGGCTGGCCTCGAACTCANAAATCCGCCTGCCTCTGCCTCCCAAGTA
CTGGGATTAAAGGTGTGAGCCACCACGCCCGGCAAAATAAAACTTTTAGAAAGCCATTTAAAAAAGTGAATATAGGGTAA
GCAAGATGGCTCCGCAGAAAAAAGTGCTTGCTATGCAACTCTGGCNGTGAGTTTGACCCATGNNNCCNNNGAAGCCACGT
AAAGGTAGAAGGAAAGAACCAATTCCACAAAGTTGTCCACTGACNTGAACATGTGGCACACTGGTACTCATATGCTTACA
CTAAAGATCAATTAAAAATAAATTNNTAAATGGAAAACATAGCTTACCAATTACTATGAATATCATAATTTTATTTNNGT
TAAATTACAAGCACATACNTACNTNNCATATATAAGATACATATGGTTATATCACAGTNNNNNCNNNTTATCTCTAATAC
TNGGGTTTTTATTTTNATCTTTGACTNNTCTAGGANNTTGNTNGNTNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000059203


For any suggestions or comments, please send an email to unitrap@crg.es