Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XS0860
Clone ID XS0860
Vector pGT0lxf
Project sanger

Sequence tag XS0860
Sequence
TGAAATATGGTGATTCTCTGTACCGATGCAAGCAGCTGAAGCGCGCGGCCCTTGGACGAATGTGTACTATTATCAAGAGA
CAGAGGCAGAGCTTGGAGTATCTGGAACAAGTACGTCAACATTTATCCCGCTTGCCAACCATTGATCCAAATACAAGGAC
TCTGCTTTTGTGTGGGTATCCAAATGTTGGGAAATCCAGCTTCATCAACAAGGTGACAAGAGCAGATGTGGACGTTCAAC
CCTATGCATTTACCACCAAATCTCTGTTTGTTGGGCACATGGATTATAAGTATCTGCGCTGGCAGGTTGTAGATACCCCA
GGGATTTTGGATCATCCTTTGGAGGATCGGAACACCATTGAGATGCAGGCCATCACAGCCCTGGCCCACCTCCGAGCTGC
AGTTCTGTATGTGATGGATCTGTCTGAGCAGTGTGGACATGGGTTAAAGGAGCAGTTAGAACTCTTCCAGAATATCAGAC
CTCTGTTTATCAACAAGCCTCTTATTGTTGTAGCAAACAAATGTGATGTGAAGAGAATAGCTGAACTTTCTGAAGAAGAT
CAG
Sequence Type mRNA
Unitrap ID UNI2525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8986495..8991071 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021149 (Gtpbp4) NM_027000 GTP binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1916487]

 
Come back to gene ENSMUSG00000021149


For any suggestions or comments, please send an email to unitrap@crg.es