Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10088G10
Clone ID IST10088G10
Vector VICTR75
Project tigm

Sequence tag IST10088G10BBR1
Sequence
AAATGACTACTGAACAGCCATTGCACTAAGCAAAGTTTATCTGAGAACCATGTACCTCTCGTGTTTCATTACAAGCGCTA
TACAGTTGATTGCATATCTCTAAGTAGCAGCATAGCACATGGTGATACATGTGTCTTGTCCAGCAGTTGGGATATGGAGG
CAGGAGGAATGAGAGTTTGGGACAACACAAAAAGTTATTACTGGTTACACTGATATTCATTTAAAGACAAACACTGGAGT
TAACCAATGCTGTTCTTCAGTATTATGTATGCTTGTTAAATATCCTAAATTCCTGTGAAAAAAGGGTAACAGCATTGGTC
TTTTCTGGGTCTATTAAGAACTAAAGGTTTGGAGAAATTGGCAAGACTCAGATACCCGTCCTCCCTTTCTTCCTCTGTTA
AATTGGATGGACTCAGTAGGCCCTCCAGAGTCCTCTGACATCTCCGTTTACTGCCAATGTTGCCAAGACCCTCCTGCAGG
TAACCACCCTTTCCTGTAAGTCAGGGTTTTCTGATGGTCTTACGCAGCCGCTGTGAGAGGATCTTTCGGCCTACAAAGGG
TTGCAGCCCACCAGTTAAGAACCATTGCTGTAAGCACTTGACCCTC
Sequence Type genomic DNA
Unitrap ID UNI24263

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 48537315..48537920 602
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023994 (Nfya) NM_010913 nuclear transcription factor-Y alpha Gene [Source:MGI Symbol;Acc:MGI:97316]


Sequence tag IST10088G10BBF1
Sequence
ATTTTGCACTTTTAGCAAAAACAAAACAGCGTAGCCGAGTCTTCCCATGTGTGCTCTCCCTTCTCCAGTGTTCATGGAAC
ACAATTCATGGAACTCTGACATGCGCTTGGATTGGGAGCTGAGGACTGAGAAAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 48537917..48538055 139
NO GENE  


Sequence tag IST10088G10HMF1
Sequence
ATTTTGCACTTTTAGCAAAAACAAAACAGCGTAGCCGAGTCTTCCCATGTGTGCTCTCCCTTCTCCAGTGTTCATGGAAC
ACAATTCATGGAACTCTGACATGCGCTTGGATTGGGAGCTGAGGACTGAGAAAGATCTGAAGCCACCTGTAGAATTTATT
CCTGTTGCTTCCTGGTCTTTCTAAAGCAACACACTTAGTGCATACTTCTGAGAAAATAGACACAGCAATCACTACATGTC
TTGGCATGGGACACTGGCATACTGGCCTCAGAGACAGGTTAGCAGCACAAAAGGCATGCGATTTTGCCATTCAATTTGAG
ATCCAAACACAAACAGCAGCAGACAGGCAGCGTTCATGCAGTGCTCACAGGGAATCAGAGAGGGCACCACTACCTGGAGG
GTCTGGACTTGCTGGCCTGAGGCGGATGCCACCTGGGCCTCAGTCTGCAGCTGGACAGCAGTGACACCACCCTGCTGCTG
AGAACAGGAAGAGGATGAGCTTGAAATGTATCAGATGGAAATATACAGCCCAAGACAGCAGATCACTCCGAGGGAGAGGG
TGGGATGCCTCTAAAGCACCTCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 48537917..48538500 578

 
Come back to gene Mm.4929


For any suggestions or comments, please send an email to unitrap@crg.es