Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12552F11
Clone ID IST12552F11
Vector VICTR76
Project tigm

Sequence tag IST12552F11BBF1
Sequence
GGTGAGATGGCTCAGTGGGTAANAGCACCCGACTGCTCTTCCGAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGG
CTCACAACCATCCGTAACGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI2631 UNI32960 UNI34672 UNI34673

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 47543674..47543779 104
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 19237616..19237721 104
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4545437..4545542 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020412 (Ascc2) NM_029291 activating signal cointegrator 1 complex subunit 2 Gene [Source:MGI (curated);Acc:Ascc2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 8659337..8659442 104
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 100532351..100532456 104
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 21715857..21715962 104
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25647809..25647914 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4893416..4893521 104
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 49189596..49189701 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040490 (Lrfn2) NM_027452 leucine rich repeat and fibronectin type III domain containing 2 Gene [Source:MGI (curated);Acc:Lrfn2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 24074359..24074464 104
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5781282..5781387 104
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 48777522..48777627 104
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 94619332..94619437 104
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 34311448..34311553 104
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125970650..125970755 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029482 (Aacs) NM_030210 acetoacetyl-CoA synthetase Gene [Source:MGI (curated);Acc:Aacs-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 37598526..37598631 104
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52218699..52218804 104
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 4483148..4483253 104
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22112682..22112787 104
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 89258846..89258951 104
NO GENE  

 
Come back to gene ENSMUSG00000029482


For any suggestions or comments, please send an email to unitrap@crg.es