Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10938H1
Clone ID IST10938H1
Vector VICTR76
Project tigm

Sequence tag IST10938H1HMR1
Sequence
GCTGTGCCTATTTNNTTTGGTTTTTACGTGTACAGAATTTTTTTGTTTGTTTTTGGTCTTTTTTTTTTTA
Sequence Type genomic DNA
Unitrap ID UNI31752

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20539171..20539239 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049800 (Sertad2) NM_001038625 SERTA domain containing 2 Gene [Source:MGI (curated);Acc:Sertad2-001]


Sequence tag IST10938H1BBF1
Sequence
CAGCAAATTTCTTACATGANAATTACACTAACTCTATAAGCATGTTTACACAGATGAATGAGTGTTTTATGTAAACAAGC
ATGCCCAATGCAAATTGGAATCCTATAAACATCGGCAGCACCACATCTACCACAAGGGGGCGCCACAGAGCAGCAAGGCA
TCTTCCAACTCCATGTCAGTTCCTACCTACAGAGTTCTCAAANCATTTACATTTCCAAATTCCATCTTCTATTCNGGTGT
TCACATGGCAATGCTGAATGCTNNAANCCTTACCAANCTCCAACTAAATTATATAATGTTATGGTACAACCTTTTATTGC
TTGTATATAAGTAACACCATGGTTAGGATCTCTGGANGATNACTGAANAGAGACACANAACCAAGCACAAATCCNAGTCA
TGAAATGTGGACTCAGANGANGCAACAGTTCAGANCCAGATCTG

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20538732..20539174 413
 
EST/CDNA Est Name
  BE370650.1

 
Come back to gene BE370650.1


For any suggestions or comments, please send an email to unitrap@crg.es