Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11600G12
Clone ID IST11600G12
Vector VICTR76
Project tigm

Sequence tag IST11600G12HMR1
Sequence
GAACCTTATATCTAATTGAGAAAATAACTGTTTTTACATATGGGGTAATTGTGGGGCAGCAGTCAGTCAGTAGTGATTTG
CTCATAAGCTATGAAGTANGCCCTGCAGACAATAGAAGCCAACAAATGAAATAAAAAAATCTGTCTTTATGATACACTTG
TACTACCGGGGAAGTGCATGTTTGTGACTCTGACTCTGTGATAAACTCGGGGAATAAACAATGCACGGAACCATGCCAAC
CACAGTGTGCTGCTCACAGACCGTGGAACTGGN
Sequence Type genomic DNA
Unitrap ID UNI400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 108626544..108626815 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032846 (Zswim6) NP_663431 zinc finger, SWIM domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1914513]


Sequence tag IST11600G12BBF1
Sequence
GTTCAATTGCACATACATTAAAATATAAATTATATATTATGTCCTACAAGGCAAATACTCAATCTTCACATGANACTCTG
TAATGGCAGCTATAGGAATAATAACTGAGTTCCTACATTANATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 108626812..108626937 122
NO GENE  

 
Come back to gene ENSMUSG00000032846


For any suggestions or comments, please send an email to unitrap@crg.es