Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14881D12
Clone ID IST14881D12
Vector VICTR76
Project tigm

Sequence tag IST14881D12BBF1
Sequence
CTTAGCAGAGGTCACCCTGCCTGCCGGGAACCCACAGGGATTCTGGATTCCTCCCCACCCAGAGGGAAGGCTATTTTTAG
TGTTCTCTTTTTCCTCNNCCCTCTCTGTCTCCCTCCTCTTCACCNNNNANNTNTTTGTCACANNGNNACNCTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14881D12HMR1
Sequence
TAAGGATCCCAGGACAGGGTTTTCTTGTGAGAAAAAGGACAAGGGTGTGAGGGAATCTGCCCAGAGGGTANAGCCAGCCT
CTACTATTCTGCTAGGACCAAACTCCTCCTGAAGTTCATGAGGACTGCTACATAGAGGAACTTGGTGGAGTANGGACTTT
TTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79990948..79991113 162
NO GENE  


Sequence tag IST14881D12HMF1
Sequence
CTTAGCAGAGGTCACCCTGCCTGCCGGGAACCCACAGGGATTCTGGATTCCTCCCCACCCAGAGGGAAGGCTATTTTTAG
TGTTCTCTTTTTCCTCAGCCCTCTCTGTCTCCCTCCTCTTCACCCCAGATGTGTTTGTCACAAGGAGACTCTTCCCATCT
GTTA
Sequence Type genomic DNA
Unitrap ID UNI31031

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79991110..79991272 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020709 (Centa2) NM_172133 ArfGAP with dual PH domains 2 Gene [Source:MGI (curated);Acc:Centa2-001]

 
Come back to gene ENSMUSG00000020709


For any suggestions or comments, please send an email to unitrap@crg.es