Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12553E9
Clone ID IST12553E9
Vector VICTR76
Project tigm

Sequence tag IST12553E9BBF1
Sequence
TTNACCACATTCAGGCACTCACGCATACACACAAATACATAAGTCAGTGGAATTTTTTAAAACAATGGCTTAAACTCACA
ACTGTCTATACACTATAGCACTCACAGGGATAAGATTTCTGACCCTAAGCCAATGAAGTCATACCCAAGCCAAGCTTCTC
TTTTGGCCCGTTAGCAATGAGCAGAGTGCTGTCCCCTGGAATCCCCTGCTTACCTCTCCCAAGGTGCCCCAGTCTCCAGC
CTGGTCTTTAGGAAGCCTCAGGATGCCACTTCTGTCACTCCATGTCACCCTATTACTCTCCCCCATCATGGATGCCTGTA
TTTAAAGATTAGCTAAGTACTCTCCTGCCCTGTCTTTGGGGAANGCTGTGGTTTTCTTCTCTTAATAGCAAGATTCCATT
TTTATTTATTTTTATGACATGAAAAGGACATTTTCTCCTCCTCCTCTCCTTCTTCCTCTCCTCCCCTCCTCCTCCTCTTC
CTCCTNNTCTTCTTTCTTCTTCTTCNNTNCNTCCTCCTCCTCCNCCTCCTNCTTCNTCNNCNNCN
Sequence Type genomic DNA
Unitrap ID UNI19923

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 61397109..61397646 506
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058806 (Col13a1) NM_007731 collagen, type XIII, alpha 1 Gene [Source:MGI (curated);Acc:Col13a1-005]


Sequence tag IST12553E9HMF1
Sequence
TTCACCACATTCAGGCACTCACGCATACACACAAATACATAAGTCAGTGGAATTTTTTAAAACAATGGCTTAAACTCACA
ACTGTCTATACACTATAGCACTCACAGGGATAANATTTCTGACCCTAAGCCAATGAAGTCATACCCAAGCCAAGCTTCTC
TTTTGGCCCGTTAGCAATGAGCAGAGTGCTGTCCCCTGGAATCCCCTGCTTACCTCTCCCAAGGTGCCCCANTCTCNANC
CTGGTCTTTAGGAAGCCTCAGGATGCCACTTCTGTCACTCCATGTCACCCTATTACTCTCCCCCATCATGGATGCCTGTA
TTTAAAGATTANCTAAGTACTCTCCTGCCCTGTCTTTGGGGAAGGCTGTGGTTTTCTTCTCTTANTANNNNGATTCNANN
NNNANTNANNNNNANNACATGAAAAGGACATTTTCTNCTNCNNCNCNCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000058806


For any suggestions or comments, please send an email to unitrap@crg.es