Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11998D3
Clone ID IST11998D3
Vector VICTR76
Project tigm

Sequence tag IST11998D3BBF1
Sequence
AGGGCTAGAAGGCTGTCTGTCCAATGAAGTCTGCAGGACAACTAANAGCAGGAAGCACAAAATCAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI34672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 49101552..49101621 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040490 (Lrfn2) NM_027452 leucine rich repeat and fibronectin type III domain containing 2 Gene [Source:MGI (curated);Acc:Lrfn2-001]

 
Come back to gene ENSMUSG00000040490


For any suggestions or comments, please send an email to unitrap@crg.es