Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14717H10
Clone ID IST14717H10
Vector VICTR76
Project tigm

Sequence tag IST14717H10HMF1
Sequence
AAATTTATTTATATAAAAATTATATAAAAAAATTTCTCTTATAAGTTGCCTTGGTTGTGATGTCACCTCACAACAATAGA
ATAGTAACTAAAACAGTGTCTTCTGTAGCTCAGGCTGGACTCTGGCTCACTGTGTTGCCAAGGCTGGCCTTGAACTCCTG
GCCCTCCTACCTTTACCTCCTGAGAAAGAATGGCANACGTGTACTGTCANACCTANTGCTAGGAGTGGAACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57007192..57007423 226
NO GENE  


Sequence tag IST14717H10HMR1
Sequence
NNATTTTATAGATAATTATTAAAATTCTTTATATAAAAGAAATTTTTAATTGAGGCTGGCTTACAGTTTAACAGATTTAG
TCCATTATCATGATGGTGGGGAGCATGGTGGAATGCATGGTCCACATTGTTATGAAATAAAACGTGGCACTGGGTAGGGG
GTACCTGGCAGGCCCATGCCAAGGTCTGTCTGAGGAATCACACCATGATACNNACCTGATTTAAGGGAAATTTACTGGGG
GTGGGGGGGCANAGGCAANCNNGACCTGGAAAAGGGCTCAATACAAAGAANGTNNGGACNGAGAGGTGCAGANAGAGAAN
NAC
Sequence Type genomic DNA
Unitrap ID UNI32092

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57006879..57007195 295
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024207 (Acsbg2) NM_001039114 acyl-CoA synthetase bubblegum family member 2 Gene [Source:MGI (curated);Acc:Acsbg2-001]

 
Come back to gene ENSMUSG00000024207


For any suggestions or comments, please send an email to unitrap@crg.es