Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14743C6
Clone ID IST14743C6
Vector VICTR76
Project tigm

Sequence tag IST14743C6HMR1
Sequence
ATGGTGTCTNACAACCGTCTGTAATGAGATCTGATGCCCTCTTCTAGGGTGTCTGAAGACNGCTACNGTTAAATTACATA
TAATAAATAAATAAATATATCTTTAAAAAAATAGATCTAGTGCATGTCAGTCTCCGACAGTCAGATATTTTGCCTTCAAA
TGAGGGCTGGGCGAGCTTTCCAGCGAGTGACAGTANATTTAACGACCATGAGGGTTAGGACCCTCAAAATCCTGGGTCTG
AGGCAACTCTGAATACATTGGGCCACTCCTCATTGGACTCTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75399253..75399534 274
 
EST/CDNA Est Name
  BB689809.1 - W35937.1 - CK794722.1 - AW989810.1 - AA470184.1 - AA237630.1 - AA543550.1 - AA423318.1 - AA245846.1 - AA272838.1 - AI131602.1 - AA461939.1 - AI882059.1 - AW742353.1 - AA014243.1 - W41006.1 - W20838.1 - W29829.1 - AA461664.1 - W09736.1 - AI117


Sequence tag IST14743C6BBF1
Sequence
ATGTGGTTGCTGGGATTTGAACTCAGGACCTTCAGAGCAGTCGGTGCTCTTAACCACTGAGCCATCTCGCCAGCCCCCAC
TA
Sequence Type genomic DNA
Unitrap ID UNI13550

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75399533..75399614 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049422 (Chchd10) NM_175329 coiled-coil-helix-coiled-coil-helix domain containing 10 Gene [Source:MGI Symbol;Acc:MGI:2143558]

 
Come back to gene ENSMUSG00000049422


For any suggestions or comments, please send an email to unitrap@crg.es